| ID |
U0005 |
|
| Creation Date |
30 September 1997 |
| Updating Date |
23 September 2009 |
|
| Standard Name |
Amyloid precursor protein mRNA stability control element (APP_SCE) |
| UTRSite Pattern |
UCUCUUUACAUUUUGGUCUCUACACUACA[3,1,0] |
| Random Expectation |
0.0000818603 hits/kb |
|
| UTR Region |
All |
| Taxon Range |
Vertebrata |
|
| Description |
Increased levels of Amyloid Precursor Protein (APP) expression are found in patients with Alzheimer's disease. APP mRNA stability is controlled by a 29-nt element in the 3-UTR of APP mRNA which has been found to interact with multiple cytosolic proteins. In resting cells, where no protein binding activity is detected, the 29-nt region acts in cis to destabilise APP mRNA (t1/2=4h). In mitogen activated peripheral blood mononuclear cells or cycling tumour cells the binding activity dramatically in...... |
|
|
| Image |
 |
|
| Feature Key |
APP_SCE |
|
| UTR(s) |
| Description |
Species |
Link |
Ref. |
| 3'UTR in Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease) (APP), transcript variant 1, mRNA. |
Homo sapiens |
UTRef: 3HSAR033574 |
[U1] |
|
| Transcript(s) |
| Description |
Species |
Link |
Ref. |
| Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease) (APP), transcript variant 1, mRNA. |
Homo sapiens |
RefSeq: NM_000484 |
[T1] |
|
| Gene(s) |
| Description |
Species |
Link |
Ref. |
| amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease) |
Homo sapiens |
EntrezGene: 351 |
[G1] |
|
|
| Binding Protein(s) |
|
|
| ID |
[1] |
| Authors |
Syed H.E. Zaidi and James S.Malter |
| Title |
Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region |
| Citation |
Journal of Biological Chemstry vol.269 n.39 pp.24007-24013 |
| Year |
1994 |
| ID |
[2] |
| Authors |
Zaidi SH, Malter JS. |
| Title |
Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA. |
| Citation |
J. Biol. Chem. 1995 Jul 21; 270(29): 17292-8 |
| Year |
1995 |
| ID |
[3] |
| Authors |
Rajagopalan LE, Malter JS. |
| Title |
Growth factor-mediated stabilization of amyloid precursor protein mRNA is mediated by a conserved 29-nucleotide sequence in the 3'-untranslated region. |
| Citation |
J. Neurochem. 2000 Jan; 74(1): 52-9 |
| Year |
2000 |
| ID |
[U1] |
| Authors |
Syed H.E. Zaidi and James S.Malter |
| Title |
Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region |
| Citation |
Journal of Biological Chemstry vol.269 n.39 pp.24007-24013 |
| Year |
1994 |
| ID |
[T1] |
| Authors |
Syed H.E. Zaidi and James S.Malter |
| Title |
Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region |
| Citation |
Journal of Biological Chemstry vol.269 n.39 pp.24007-24013 |
| Year |
1994 |
| ID |
[G1] |
| Authors |
Syed H.E. Zaidi and James S.Malter |
| Title |
Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region |
| Citation |
Journal of Biological Chemstry vol.269 n.39 pp.24007-24013 |
| Year |
1994 |
| ID |
[B1] |
| Authors |
Zaidi SH, Malter JS. |
| Title |
Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA. |
| Citation |
J. Biol. Chem. 1995 Jul 21; 270(29): 17292-8 |
| Year |
1995 |
| ID |
[B2] |
| Authors |
Zaidi SH, Malter JS. |
| Title |
Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA. |
| Citation |
J. Biol. Chem. 1995 Jul 21; 270(29): 17292-8 |
| Year |
1995 |
