UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID U0005
Creation Date 30 September 1997
Updating Date 23 September 2009
Standard Name Amyloid precursor protein mRNA stability control element (APP_SCE)
UTRSite Pattern 
UCUCUUUACAUUUUGGUCUCUACACUACA[3,1,0]
Random Expectation 0.0000818603 hits/kb
::Taxonomy
UTR Region All
Taxon Range Vertebrata
::Description
Description Increased levels of Amyloid Precursor Protein (APP) expression are found in patients with Alzheimer's disease. APP mRNA stability is controlled by a 29-nt element in the 3-UTR of APP mRNA which has been found to interact with multiple cytosolic proteins. In resting cells, where no protein binding activity is detected, the 29-nt region acts in cis to destabilise APP mRNA (t1/2=4h). In mitogen activated peripheral blood mononuclear cells or cycling tumour cells the binding activity dramatically in......
Image
::Features
Feature Key APP_SCE
::Transcript(s) / Gene(s)
UTR(s)
Description Species Link Ref.
3'UTR in Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease) (APP), transcript variant 1, mRNA. Homo sapiens UTRef: 3HSAR033574 [U1]
Transcript(s)
Description Species Link Ref.
Homo sapiens amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease) (APP), transcript variant 1, mRNA. Homo sapiens RefSeq: NM_000484 [T1]
Gene(s)
Description Species Link Ref.
amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease) Homo sapiens EntrezGene: 351 [G1]
::Protein(s)
Binding Protein(s)
Description Species Link Ref.
nucleolin Homo sapiens RefSeq: NP_005372 [B1]
heterogeneous nuclear ribonucleoprotein C isoform a Homo sapiens RefSeq: NP_001070910 [B2]
::References
ID [1]
Authors Syed H.E. Zaidi and James S.Malter
Title Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region
Citation Journal of Biological Chemstry vol.269 n.39 pp.24007-24013
Year 1994
ID [2]
Authors Zaidi SH, Malter JS.
Title Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA.
Citation J. Biol. Chem. 1995 Jul 21; 270(29): 17292-8
Year 1995
ID [3]
Authors Rajagopalan LE, Malter JS.
Title Growth factor-mediated stabilization of amyloid precursor protein mRNA is mediated by a conserved 29-nucleotide sequence in the 3'-untranslated region.
Citation J. Neurochem. 2000 Jan; 74(1): 52-9
Year 2000
ID [U1]
Authors Syed H.E. Zaidi and James S.Malter
Title Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region
Citation Journal of Biological Chemstry vol.269 n.39 pp.24007-24013
Year 1994
ID [T1]
Authors Syed H.E. Zaidi and James S.Malter
Title Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region
Citation Journal of Biological Chemstry vol.269 n.39 pp.24007-24013
Year 1994
ID [G1]
Authors Syed H.E. Zaidi and James S.Malter
Title Amyloid precursor protein mRNA stability is controlled by a 29-Base element in the 3'-Untranslated region
Citation Journal of Biological Chemstry vol.269 n.39 pp.24007-24013
Year 1994
ID [B1]
Authors Zaidi SH, Malter JS.
Title Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA.
Citation J. Biol. Chem. 1995 Jul 21; 270(29): 17292-8
Year 1995
ID [B2]
Authors Zaidi SH, Malter JS.
Title Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA.
Citation J. Biol. Chem. 1995 Jul 21; 270(29): 17292-8
Year 1995
Links