| ID |
U0016 |
|
| Creation Date |
08 May 2000 |
| Updating Date |
24 September 2009 |
|
| Standard Name |
SXL binding site |
| UTRSite Pattern |
((((
UUUUUUUUUUUUUUUU[0,5,0]|
UUUUUUUUU 14...14 UUUUUUU 14...14 UUUUUUU 9...9 UUUUUUU)|
UCUUUUUGUUGUUUUUUUUCUAG)|
UAUUUUUUUUCACAG)|
UUUUUUGUUKUKUUUKUU)
|
|
|
| UTR Region |
All |
| Taxon Range |
Arthropoda |
|
| Description |
Sex-lethal (SXL) is a female-specific RNA binding protein of Drosophila
melanogaster that functions as the master regulator of sex
determination and X chromosome dosage compensation. SXL regulates the
expression of downstream target genes via the modulation of splicing
and translation. SXL controls the splicing of its own pre-mRNA,
establishing a positive feed-back autoregulatory loop that perpetuates
its own production in females. Other targets of SXL are tra pre-mRNA,
which encodes another female-specific splicing regulator, and msl-2
pre-mRNA, encoding a critical component of the dosage compensation
complex. While SXL promotes an alternative splicing pattern of tra
pre-mRNA that results in TRA expression, it inhibits the expression of
MSL-2 via a mechanism that includes the repression of both the splicing
and the translation of msl-2 mRNA.
SXL
binds to polyuridine tracts of eight or more residues with a Kd ~1nM,
although it can also bind U7-U5 depending on the sequence context
(Valcárcel et al., 1993; Samuels et al., 1994; Wang and Bell, 1994). It
was found that an adenosine residue located immediately upstream of the
poly(U) increased binding efficiency (Samuels et al., 1994). Two SELEX
studies have been performed to find the optimal SXL-binding site. One
of them yielded the consensus AUnNnAGU (Sakashita and Sakamoto, 1994),
while the other generated the consensus U6GU2KUKU3KU2 (K= G or U; Singh et
al., 1995), which fits well with the known SXL-binding sites (see table
below). Disruption of the polyuridine tract with cytosine disrupts SXL
binding (Sosnowski et al, 1989; Inoue et al, 1990; Samuels et al.,
1994; Singh et al., 1995).
SXL contains a glycine/ asparagine
(GN)- rich amino terminus followed by two RNP-type RNA binding domains
(RBDs). NMR and X-ray determination of SXL crystal structure indicate
that, in the absence of RNA, the RBDs are flexibly tethered in
solution, with no interdomain contacts (Crowder et al., 1999). However,
upon RNA binding, interdomain contacts are induced, and the RBDs adopt
a V shape structure where the RNA is sandwiched in an extended
conformation (Handa et al., 1999). Site-specific photocrosslinking and
chemical cleavage experiments suggest that SXL binds to the RNA in
multiple registers, yielding an ensemble of SXL-RNA complexes in rapid
equilibrium (Banerjee et al., 2003).
SXL has been shown to
dimerize through the RBDs (Samuels et al., 1998). In addition, SXL
contacts the snRNP component SNF and the protein of unknown function
SIN through the first RBD (Samuels et al., 1998; Dong and Bell, 1999).
The GN-rich amino terminus is the site of interaction with the splicing
factor SPF45 (Lallena et al., 2002), and mediates cooperative
interactions for RNA binding (Wang and Bell, 1994).
Table. SXL binding sites in msl-2, sxl and tra pre-mRNAs.
pre-mRNA
| Db:AC
| Location
| Binding Site
| Reference
| msl-2 (5'UTR-a)
| RefSeq:NM_078743
| 65…75
| U11
| Kelley et al.,1995
| | msl-2 (5'UTR-b) | RefSeq:NM_078743
| 163…178
| U16
| Kelley et al.,1995
| msl-2 (3'UTR)
| RefSeq:NM_078743
| 3659…3725
| U9 N14 U7 N14 U7 N9 U7
| Kelley et al.,1995
| sxl (intron 2)
| Ensembl:CG33070-RA
| 9307...9321
| UAU8CACAG
| Sakamoto et al., 1992
| tra (intron 1)
| Ensembl:CG16724-RA
| 91...113
| UCU5GUUGU8CUAG
| Sosnowski et al., 1989
|
|
|
|
|
| Feature Key |
SXL_BS |
|
| UTR(s) |
| Description |
Species |
Link |
Ref. |
| 3'UTR in Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds. |
Drosophila melanogaster |
UTRef: 3DMER003924 |
[U1] |
| 5'UTR in Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds. |
Drosophila melanogaster |
UTRef: 5DMER003913 |
[U2] |
|
| Transcript(s) |
| Description |
Species |
Link |
Ref. |
| Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds |
Drosophila melanogaster |
RefSeq: NM_078743 |
[T1] |
|
| Gene(s) |
|
|
| Binding Protein(s) |
| Description |
Species |
Link |
Ref. |
| Sex-lethal protein (SXL) |
Drosophila melanogaster |
UniProt: P19339 |
[B1] |
|
| Interactor(s) of Binding Protein(s) |
|
|
| ID |
[1] |
| Authors |
Gebauer, F., Corona, D.F., Preiss, T., Becker, P.B. and Hentze, M.W. |
| Title |
Translational control of dosage compensation in Drosophila by Sex- lethal: cooperative silencing via the 5' and 3' UTRs of msl-2 mRNA is independent of the poly(A) tail |
| Citation |
Embo J, 18, 6146-6154 |
| Year |
1999 |
| ID |
[2] |
| Authors |
Banerjee H, Rahn A, Davis W, Singh R. |
| Title |
Sex lethal and U2 small nuclear ribonucleoprotein auxiliary factor (U2AF65) recognize polypyrimidine tracts using multiple modes of binding. |
| Citation |
RNA 9:88-99. |
| Year |
2003 |
| ID |
[3] |
| Authors |
Crowder SM, Kanaar R, Rio DC, Alber T. |
| Title |
Absence of interdomain contacts in the crystal structure of the RNA recognition motifs of Sex-lethal. |
| Citation |
Proc Natl Acad Sci U S A. 96:4892-7. |
| Year |
1999 |
| ID |
[4] |
| Authors |
Dong Z, Bell LR |
| Title |
SIN, a novel Drosophila protein that associates with the RNA binding protein sex-lethal |
| Citation |
Gene 237:421-8 |
| Year |
1999 |
| ID |
[5] |
| Authors |
Handa N, Nureki O, Kurimoto K, Kim I, Sakamoto H, Shimura Y, Muto Y, Yokoyama S. |
| Title |
Structural basis for recognition of the tra mRNA precursor by the Sex-lethal protein |
| Citation |
Nature 398:579-85 |
| Year |
1999 |
| ID |
[6] |
| Authors |
Inoue K, Hoshijima K, Sakamoto H, Shimura Y. |
| Title |
Binding of the Drosophila sex-lethal gene product to the alternative splice site of transformer primary transcript |
| Citation |
Nature 344:461-3. |
| Year |
1990 |
| ID |
[7] |
| Authors |
Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI. |
| Title |
Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila. |
| Citation |
Cell. 81:867-77. |
| Year |
1995 |
| ID |
[8] |
| Authors |
Lallena MJ, Chalmers KJ, Llamazares S, Lamond AI, Valcarcel J. |
| Title |
Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45. |
| Citation |
Cell 109:285-96. |
| Year |
2002 |
| ID |
[9] |
| Authors |
Sakamoto H, Inoue K, Higuchi I, Ono Y, Shimura Y. |
| Title |
Control of Drosophila Sex-lethal pre-mRNA splicing by its own female-specific product |
| Citation |
Nucleic Acids Res. 20:5533-40. |
| Year |
1992 |
| ID |
[10] |
| Authors |
Sakashita E, Sakamoto H. |
| Title |
Characterization of RNA binding specificity of the Drosophila sex-lethal protein by in vitro ligand selection. |
| Citation |
Nucleic Acids Res. 22:4082-6. |
| Year |
1994 |
| ID |
[11] |
| Authors |
Samuels ME, Bopp D, Colvin RA, Roscigno RF, Garcia-Blanco MA, Schedl P. |
| Title |
RNA binding by Sxl proteins in vitro and in vivo. |
| Citation |
Mol Cell Biol. 14:4975-90. |
| Year |
1994 |
| ID |
[12] |
| Authors |
Samuels M, Deshpande G, Schedl P. |
| Title |
Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
|
| Citation |
Nucleic Acids Res. 26:2625-37. |
| Year |
1998 |
| ID |
[13] |
| Authors |
Sosnowski BA, Belote JM, McKeown M. |
| Title |
Sex-specific alternative splicing of RNA from the transformer gene results from sequence-dependent splice site blockage. |
| Citation |
Cell 58:449-59. |
| Year |
1989 |
| ID |
[14] |
| Authors |
Singh R, Valcarcel J, Green MR. |
| Title |
Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. |
| Citation |
Science 268:1173-6. |
| Year |
1995 |
| ID |
[15] |
| Authors |
Valcarcel J, Singh R, Zamore PD, Green MR. |
| Title |
The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA. |
| Citation |
Nature 362:171-5. |
| Year |
1993 |
| ID |
[16] |
| Authors |
Wang J, Bell LR. |
| Title |
The Sex-lethal amino terminus mediates cooperative interactions in RNA binding and is essential for splicing regulation. |
| Citation |
Genes Dev. 8:2072-85. |
| Year |
1994 |
| ID |
[U1] |
| Authors |
Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI. |
| Title |
Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila. |
| Citation |
Cell. 81:867-77. |
| Year |
1995 |
| ID |
[U2] |
| Authors |
Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI. |
| Title |
Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila. |
| Citation |
Cell. 81:867-77. |
| Year |
1995 |
| ID |
[T1] |
| Authors |
Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI. |
| Title |
Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila. |
| Citation |
Cell. 81:867-77. |
| Year |
1995 |
| ID |
[G1] |
| Authors |
Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI. |
| Title |
Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila. |
| Citation |
Cell. 81:867-77. |
| Year |
1995 |
| ID |
[B1] |
| Authors |
Samuels M, Deshpande G, Schedl P. |
| Title |
Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
|
| Citation |
Nucleic Acids Res. 26:2625-37. |
| Year |
1998 |
| ID |
[P1] |
| Authors |
Dong Z, Bell LR |
| Title |
SIN, a novel Drosophila protein that associates with the RNA binding protein sex-lethal |
| Citation |
Gene 237:421-8 |
| Year |
1999 |
| ID |
[P2] |
| Authors |
Samuels M, Deshpande G, Schedl P. |
| Title |
Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
|
| Citation |
Nucleic Acids Res. 26:2625-37. |
| Year |
1998 |
| ID |
[P3] |
| Authors |
Lallena MJ, Chalmers KJ, Llamazares S, Lamond AI, Valcarcel J. |
| Title |
Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45. |
| Citation |
Cell 109:285-96. |
| Year |
2002 |
| ID |
[P4] |
| Authors |
Samuels M, Deshpande G, Schedl P. |
| Title |
Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
|
| Citation |
Nucleic Acids Res. 26:2625-37. |
| Year |
1998 |
