UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID U0016
Creation Date 08 May 2000
Updating Date 24 September 2009
Standard Name SXL binding site
UTRSite Pattern
((((
UUUUUUUUUUUUUUUU[0,5,0]|
UUUUUUUUU 14...14 UUUUUUU 14...14 UUUUUUU 9...9 UUUUUUU)|
UCUUUUUGUUGUUUUUUUUCUAG)|
UAUUUUUUUUCACAG)|
UUUUUUGUUKUKUUUKUU)
::Taxonomy
UTR Region All
Taxon Range Arthropoda
::Description
Description Sex-lethal (SXL) is a female-specific RNA binding protein of Drosophila melanogaster that functions as the master regulator of sex determination and X chromosome dosage compensation. SXL regulates the expression of downstream target genes via the modulation of splicing and translation. SXL controls the splicing of its own pre-mRNA, establishing a positive feed-back autoregulatory loop that perpetuates its own production in females. Other targets of SXL are tra pre-mRNA, which encodes another female-specific splicing regulator, and msl-2 pre-mRNA, encoding a critical component of the dosage compensation complex. While SXL promotes an alternative splicing pattern of tra pre-mRNA that results in TRA expression, it inhibits the expression of MSL-2 via a mechanism that includes the repression of both the splicing and the translation of msl-2 mRNA.

SXL binds to polyuridine tracts of eight or more residues with a Kd ~1nM, although it can also bind U7-U5 depending on the sequence context (Valcárcel et al., 1993; Samuels et al., 1994; Wang and Bell, 1994). It was found that an adenosine residue located immediately upstream of the poly(U) increased binding efficiency (Samuels et al., 1994). Two SELEX studies have been performed to find the optimal SXL-binding site. One of them yielded the consensus AUnNnAGU (Sakashita and Sakamoto, 1994), while the other generated the consensus U6GU2KUKU3KU2 (K= G or U; Singh et al., 1995), which fits well with the known SXL-binding sites (see table below). Disruption of the polyuridine tract with cytosine disrupts SXL binding (Sosnowski et al, 1989; Inoue et al, 1990; Samuels et al., 1994; Singh et al., 1995).

SXL contains a glycine/ asparagine (GN)- rich amino terminus followed by two RNP-type RNA binding domains (RBDs). NMR and X-ray determination of SXL crystal structure indicate that, in the absence of RNA, the RBDs are flexibly tethered in solution, with no interdomain contacts (Crowder et al., 1999). However, upon RNA binding, interdomain contacts are induced, and the RBDs adopt a V shape structure where the RNA is sandwiched in an extended conformation (Handa et al., 1999). Site-specific photocrosslinking and chemical cleavage experiments suggest that SXL binds to the RNA in multiple registers, yielding an ensemble of SXL-RNA complexes in rapid equilibrium (Banerjee et al., 2003).

SXL has been shown to dimerize through the RBDs (Samuels et al., 1998). In addition, SXL contacts the snRNP component SNF and the protein of unknown function SIN through the first RBD (Samuels et al., 1998; Dong and Bell, 1999). The GN-rich amino terminus is the site of interaction with the splicing factor SPF45 (Lallena et al., 2002), and mediates cooperative interactions for RNA binding (Wang and Bell, 1994).


Table. SXL binding sites in msl-2, sxl and tra pre-mRNAs.

pre-mRNA
Db:AC
Location
Binding Site
Reference
msl-2 (5'UTR-a)
RefSeq:NM_078743
65…75
U11
Kelley et al.,1995
msl-2 (5'UTR-b)RefSeq:NM_078743
163…178
U16
Kelley et al.,1995
msl-2 (3'UTR)
RefSeq:NM_078743
3659…3725
U9 N14 U7 N14 U7 N9 U7
Kelley et al.,1995
sxl (intron 2)
Ensembl:CG33070-RA
9307...9321
UAU8CACAG
Sakamoto et al., 1992
tra (intron 1)
Ensembl:CG16724-RA
91...113
UCU5GUUGU8CUAG
Sosnowski et al., 1989

::Features
Feature Key SXL_BS
::Transcript(s) / Gene(s)
UTR(s)
Description Species Link Ref.
3'UTR in Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds. Drosophila melanogaster UTRef: 3DMER003924 [U1]
5'UTR in Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds. Drosophila melanogaster UTRef: 5DMER003913 [U2]
Transcript(s)
Description Species Link Ref.
Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds Drosophila melanogaster RefSeq: NM_078743 [T1]
Gene(s)
Description Species Link Ref.
msl-2 Drosophila melanogaster ENSEMBL: CG3241 [G1]
::Protein(s)
Binding Protein(s)
Description Species Link Ref.
Sex-lethal protein (SXL) Drosophila melanogaster UniProt: P19339 [B1]
Interactor(s) of Binding Protein(s)
Description Species Link Ref.
Sex-lethal interactor (SIN) Drosophila melanogaster UniProt: Q9U778 [P1]
U1 small nuclear ribonucleoprotein A (SNF) Drosophila melanogaster UniProt: P43332 [P2]
45 kDa Splicing Factor (SPF45) Drosophila melanogaster UniProt: Q96I25 [P3]
Sex-lethal protein (SXL) Drosophila melanogaster UniProt: P19339 [P4]
::References
ID [1]
Authors Gebauer, F., Corona, D.F., Preiss, T., Becker, P.B. and Hentze, M.W.
Title Translational control of dosage compensation in Drosophila by Sex- lethal: cooperative silencing via the 5' and 3' UTRs of msl-2 mRNA is independent of the poly(A) tail
Citation Embo J, 18, 6146-6154
Year 1999
ID [2]
Authors Banerjee H, Rahn A, Davis W, Singh R.
Title Sex lethal and U2 small nuclear ribonucleoprotein auxiliary factor (U2AF65) recognize polypyrimidine tracts using multiple modes of binding.
Citation RNA 9:88-99.
Year 2003
ID [3]
Authors Crowder SM, Kanaar R, Rio DC, Alber T.
Title Absence of interdomain contacts in the crystal structure of the RNA recognition motifs of Sex-lethal.
Citation Proc Natl Acad Sci U S A. 96:4892-7.
Year 1999
ID [4]
Authors Dong Z, Bell LR
Title SIN, a novel Drosophila protein that associates with the RNA binding protein sex-lethal
Citation Gene 237:421-8
Year 1999
ID [5]
Authors Handa N, Nureki O, Kurimoto K, Kim I, Sakamoto H, Shimura Y, Muto Y, Yokoyama S.
Title Structural basis for recognition of the tra mRNA precursor by the Sex-lethal protein
Citation Nature 398:579-85
Year 1999
ID [6]
Authors Inoue K, Hoshijima K, Sakamoto H, Shimura Y.
Title Binding of the Drosophila sex-lethal gene product to the alternative splice site of transformer primary transcript
Citation Nature 344:461-3.
Year 1990
ID [7]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [8]
Authors Lallena MJ, Chalmers KJ, Llamazares S, Lamond AI, Valcarcel J.
Title Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45.
Citation Cell 109:285-96.
Year 2002
ID [9]
Authors Sakamoto H, Inoue K, Higuchi I, Ono Y, Shimura Y.
Title Control of Drosophila Sex-lethal pre-mRNA splicing by its own female-specific product
Citation Nucleic Acids Res. 20:5533-40.
Year 1992
ID [10]
Authors Sakashita E, Sakamoto H.
Title Characterization of RNA binding specificity of the Drosophila sex-lethal protein by in vitro ligand selection.
Citation Nucleic Acids Res. 22:4082-6.
Year 1994
ID [11]
Authors Samuels ME, Bopp D, Colvin RA, Roscigno RF, Garcia-Blanco MA, Schedl P.
Title RNA binding by Sxl proteins in vitro and in vivo.
Citation Mol Cell Biol. 14:4975-90.
Year 1994
ID [12]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998
ID [13]
Authors Sosnowski BA, Belote JM, McKeown M.
Title Sex-specific alternative splicing of RNA from the transformer gene results from sequence-dependent splice site blockage.
Citation Cell 58:449-59.
Year 1989
ID [14]
Authors Singh R, Valcarcel J, Green MR.
Title Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Citation Science 268:1173-6.
Year 1995
ID [15]
Authors Valcarcel J, Singh R, Zamore PD, Green MR.
Title The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA.
Citation Nature 362:171-5.
Year 1993
ID [16]
Authors Wang J, Bell LR.
Title The Sex-lethal amino terminus mediates cooperative interactions in RNA binding and is essential for splicing regulation.
Citation Genes Dev. 8:2072-85.
Year 1994
ID [U1]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [U2]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [T1]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [G1]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [B1]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998
ID [P1]
Authors Dong Z, Bell LR
Title SIN, a novel Drosophila protein that associates with the RNA binding protein sex-lethal
Citation Gene 237:421-8
Year 1999
ID [P2]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998
ID [P3]
Authors Lallena MJ, Chalmers KJ, Llamazares S, Lamond AI, Valcarcel J.
Title Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45.
Citation Cell 109:285-96.
Year 2002
ID [P4]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998