UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID U0016
Creation Date 08 May 2000
Updating Date 24 September 2009
Standard Name SXL binding site
UTRSite Pattern 
((((
UUUUUUUUUUUUUUUU[0,5,0]|
UUUUUUUUU 14...14 UUUUUUU 14...14 UUUUUUU 9...9 UUUUUUU)|
UCUUUUUGUUGUUUUUUUUCUAG)|
UAUUUUUUUUCACAG)|
UUUUUUGUUKUKUUUKUU)
::Taxonomy
UTR Region All
Taxon Range Arthropoda
::Description
Description Sex-lethal (SXL) is a female-specific RNA binding protein of Drosophila melanogaster that functions as the master regulator of sex determination and X chromosome dosage compensation. SXL regulates the expression of downstream target genes via the modulation of splicing and translation. SXL controls the splicing of its own pre-mRNA, establishing a positive feed-back autoregulatory loop that perpetuates its own production in females. Other targets of SXL are tra pre-mRNA, which encodes anot......
::Features
Feature Key SXL_BS
::Transcript(s) / Gene(s)
UTR(s)
Description Species Link Ref.
3'UTR in Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds. Drosophila melanogaster UTRef: 3DMER003924 [U1]
5'UTR in Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds. Drosophila melanogaster UTRef: 5DMER003913 [U2]
Transcript(s)
Description Species Link Ref.
Drosophila melanogaster CG3241-PA, isoform A (msl-2) mRNA, complete cds Drosophila melanogaster RefSeq: NM_078743 [T1]
Gene(s)
Description Species Link Ref.
msl-2 Drosophila melanogaster ENSEMBL: CG3241 [G1]
::Protein(s)
Binding Protein(s)
Description Species Link Ref.
Sex-lethal protein (SXL) Drosophila melanogaster UniProt: P19339 [B1]
Interactor(s) of Binding Protein(s)
Description Species Link Ref.
Sex-lethal interactor (SIN) Drosophila melanogaster UniProt: Q9U778 [P1]
U1 small nuclear ribonucleoprotein A (SNF) Drosophila melanogaster UniProt: P43332 [P2]
45 kDa Splicing Factor (SPF45) Drosophila melanogaster UniProt: Q96I25 [P3]
Sex-lethal protein (SXL) Drosophila melanogaster UniProt: P19339 [P4]
::References
ID [1]
Authors Gebauer, F., Corona, D.F., Preiss, T., Becker, P.B. and Hentze, M.W.
Title Translational control of dosage compensation in Drosophila by Sex- lethal: cooperative silencing via the 5' and 3' UTRs of msl-2 mRNA is independent of the poly(A) tail
Citation Embo J, 18, 6146-6154
Year 1999
ID [2]
Authors Banerjee H, Rahn A, Davis W, Singh R.
Title Sex lethal and U2 small nuclear ribonucleoprotein auxiliary factor (U2AF65) recognize polypyrimidine tracts using multiple modes of binding.
Citation RNA 9:88-99.
Year 2003
ID [3]
Authors Crowder SM, Kanaar R, Rio DC, Alber T.
Title Absence of interdomain contacts in the crystal structure of the RNA recognition motifs of Sex-lethal.
Citation Proc Natl Acad Sci U S A. 96:4892-7.
Year 1999
ID [4]
Authors Dong Z, Bell LR
Title SIN, a novel Drosophila protein that associates with the RNA binding protein sex-lethal
Citation Gene 237:421-8
Year 1999
ID [5]
Authors Handa N, Nureki O, Kurimoto K, Kim I, Sakamoto H, Shimura Y, Muto Y, Yokoyama S.
Title Structural basis for recognition of the tra mRNA precursor by the Sex-lethal protein
Citation Nature 398:579-85
Year 1999
ID [6]
Authors Inoue K, Hoshijima K, Sakamoto H, Shimura Y.
Title Binding of the Drosophila sex-lethal gene product to the alternative splice site of transformer primary transcript
Citation Nature 344:461-3.
Year 1990
ID [7]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [8]
Authors Lallena MJ, Chalmers KJ, Llamazares S, Lamond AI, Valcarcel J.
Title Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45.
Citation Cell 109:285-96.
Year 2002
ID [9]
Authors Sakamoto H, Inoue K, Higuchi I, Ono Y, Shimura Y.
Title Control of Drosophila Sex-lethal pre-mRNA splicing by its own female-specific product
Citation Nucleic Acids Res. 20:5533-40.
Year 1992
ID [10]
Authors Sakashita E, Sakamoto H.
Title Characterization of RNA binding specificity of the Drosophila sex-lethal protein by in vitro ligand selection.
Citation Nucleic Acids Res. 22:4082-6.
Year 1994
ID [11]
Authors Samuels ME, Bopp D, Colvin RA, Roscigno RF, Garcia-Blanco MA, Schedl P.
Title RNA binding by Sxl proteins in vitro and in vivo.
Citation Mol Cell Biol. 14:4975-90.
Year 1994
ID [12]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998
ID [13]
Authors Sosnowski BA, Belote JM, McKeown M.
Title Sex-specific alternative splicing of RNA from the transformer gene results from sequence-dependent splice site blockage.
Citation Cell 58:449-59.
Year 1989
ID [14]
Authors Singh R, Valcarcel J, Green MR.
Title Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Citation Science 268:1173-6.
Year 1995
ID [15]
Authors Valcarcel J, Singh R, Zamore PD, Green MR.
Title The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA.
Citation Nature 362:171-5.
Year 1993
ID [16]
Authors Wang J, Bell LR.
Title The Sex-lethal amino terminus mediates cooperative interactions in RNA binding and is essential for splicing regulation.
Citation Genes Dev. 8:2072-85.
Year 1994
ID [U1]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [U2]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [T1]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [G1]
Authors Kelley RL, Solovyeva I, Lyman LM, Richman R, Solovyev V, Kuroda MI.
Title Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila.
Citation Cell. 81:867-77.
Year 1995
ID [B1]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998
ID [P1]
Authors Dong Z, Bell LR
Title SIN, a novel Drosophila protein that associates with the RNA binding protein sex-lethal
Citation Gene 237:421-8
Year 1999
ID [P2]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998
ID [P3]
Authors Lallena MJ, Chalmers KJ, Llamazares S, Lamond AI, Valcarcel J.
Title Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45.
Citation Cell 109:285-96.
Year 2002
ID [P4]
Authors Samuels M, Deshpande G, Schedl P.
Title Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.
Citation Nucleic Acids Res. 26:2625-37.
Year 1998