UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID U0018
Creation Date 01 December 2000
Updating Date 01 December 2000
Standard Name Ribosomal S12 mitochondrial protein 5'UTR translation control element (RPMS12_TCE)
UTRSite Pattern
CCGCGACCTCACCTTTAGGTCCTGTG[3,0,0]
Random Expectation 0.0 hits/kb
::Taxonomy
UTR Region 5'
Taxon Range Vertebrata
::Description
Description Expression of RPMS12 gene, coding for a mitochondrial ribosomal S12 protein is controlled at level of transcription, splicing and translation in response to as yet unidentified signals mediating growth, tissue specificity and metabolic requirements.For this mRNA three splice variants of 5'UTR have been detected with only the shortest one found to be regulated by growth status. A 26 nt tract was found to be essential for post-transcriptional down-regulation, in growth-inhibited cells.
::Features
Feature Key RPMS12_TCE
::Transcript(s) / Gene(s)
UTR(s)
Description Species Link Ref.
5'UTR in Homo sapiens mitochondrial ribosomal protein S12 (MRPS12), nucleargene encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens UTRef: 5HSAR021481 [U1]
Transcript(s)
Description Species Link Ref.
Homo sapiens mitochondrial ribosomal protein S12 (MRPS12), nucleargene encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens RefSeq: NM_021107 [T1]
Gene(s)
Description Species Link Ref.
MRPS12 mitochondrial ribosomal protein S12. Homo sapiens RefSeq: 6183 [G1]
::References
ID [1]
Authors Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT.
Title Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation
Citation J Biol Chem. 5;274(45):31853-62
Year 1999
ID [U1]
Authors Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT.
Title Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation
Citation J Biol Chem. 5;274(45):31853-62
Year 1999
ID [T1]
Authors Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT.
Title Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation
Citation J Biol Chem. 5;274(45):31853-62
Year 1999
ID [G1]
Authors Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT.
Title Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation
Citation J Biol Chem. 5;274(45):31853-62
Year 1999
Links