ID |
U0018 |
Creation Date |
01 December 2000 |
Updating Date |
01 December 2000 |
Standard Name |
Ribosomal S12 mitochondrial protein 5'UTR translation control element (RPMS12_TCE) |
UTRSite Pattern |
CCGCGACCTCACCTTTAGGTCCTGTG[3,0,0]
|
Random Expectation |
0.0 hits/kb |
UTR Region |
5' |
Taxon Range |
Vertebrata |
Description |
Expression of RPMS12 gene, coding for a mitochondrial
ribosomal S12 protein is controlled at level of transcription,
splicing and translation in response to as yet unidentified
signals mediating growth, tissue specificity and metabolic
requirements.For this mRNA three splice variants of 5'UTR
have been detected with only the shortest one found to be
regulated by growth status. A 26 nt tract was found to be
essential for post-transcriptional down-regulation, in
growth-inhibited cells.
|
|
Feature Key |
RPMS12_TCE |
UTR(s) |
Description |
Species |
Link |
Ref. |
5'UTR in Homo sapiens mitochondrial ribosomal protein S12 (MRPS12), nucleargene encoding mitochondrial protein, transcript variant 1, mRNA. |
Homo sapiens |
UTRef: 5HSAR021481 |
[U1] |
|
Transcript(s) |
Description |
Species |
Link |
Ref. |
Homo sapiens mitochondrial ribosomal protein S12 (MRPS12), nucleargene encoding mitochondrial protein, transcript variant 1, mRNA. |
Homo sapiens |
RefSeq: NM_021107 |
[T1] |
|
Gene(s) |
Description |
Species |
Link |
Ref. |
MRPS12 mitochondrial ribosomal protein S12. |
Homo sapiens |
RefSeq: 6183 |
[G1] |
|
ID |
[1] |
Authors |
Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT. |
Title |
Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation |
Citation |
J Biol Chem. 5;274(45):31853-62 |
Year |
1999 |
ID |
[U1] |
Authors |
Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT. |
Title |
Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation |
Citation |
J Biol Chem. 5;274(45):31853-62 |
Year |
1999 |
ID |
[T1] |
Authors |
Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT. |
Title |
Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation |
Citation |
J Biol Chem. 5;274(45):31853-62 |
Year |
1999 |
ID |
[G1] |
Authors |
Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, Jacobs HT. |
Title |
Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation |
Citation |
J Biol Chem. 5;274(45):31853-62 |
Year |
1999 |