UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID UX0003
Creation Date 02 September 2004
Updating Date 08 August 2007
Standard Name Translation modulators ATF4 uORFs
UTRSite Pattern
1.
ATGGCKYWYTAR

2.
ATGGCGCTTCTCACGGCATTCAGCAGCAGCGTTGCTGTAACCGACAAAGACACCTTCGAATTAAGCACATTCCTCGATTCCAGCAAAGCACCGCAACATGACCGAAATGAGCTTCCTGAGCAGCGAGGTGTTGGTGGGGGACTTGATGTCCCCCTTCGACCAGTCGGGTTTGGGGGCTGA
::Taxonomy
UTR Region All
::Description
Description

ATF4 is a basic zipper transcriptional regulatory factor. Levels of ATF4 protein increase in response to eIF2 phosphorylation during amino acid starvation or ER stress. Enhanced levels of ATF4 induce a cascade of transcriptional regulators including CHOP/GADD153 and ATF3, contributing to a program of stress gene expression important for cellular metabolism, the redox status of the cell, and apoptosis. The 5'untranslated region includes two uORFs, the first encodes a polypeptide only three amino acids in length, whereas the second uORF is 59 amino acids in length and overlaps the first 83 nt of coding region. uORF-1 is a positive-acting element that facilitates translation of the ATF4 coding region in response to stress-induced eIF2 phosphorylation. In contrast uORF-2 is inhibitory, blocking ATF4 expression in non-stressed cells.

This uORF has been characterized in mouse, and is also conserved in human, chimp, rhesus, cock and dog mRNAs.

::Features
Feature Key uORF
::Transcript(s) / Gene(s)
UTR(s)
Description Species Link Ref.
Activating transcription factor 4 (ATF4) Mus musculus UTRef: BR079576 [U1]
Transcript(s)
Description Species Link Ref.
Activating transcription factor 4 (ATF4) Mus musculus RefSeq: NM_009716 [T1]
Gene(s)
Description Species Link Ref.
Activating transcription factor 4 (ATF4) Mus musculus EntrezGene: 11911 [G1]
::References
ID [1]
Authors Vattem KM, Wek RC
Title Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells.
Citation Proc Natl Acad Sci U S A. 2004 Jul 26
Year 2004
ID [U1]
Authors Vattem KM, Wek RC
Title Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells.
Citation Proc Natl Acad Sci U S A. 2004 Jul 26
Year 2004
ID [T1]
Authors Vattem KM, Wek RC
Title Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells.
Citation Proc Natl Acad Sci U S A. 2004 Jul 26
Year 2004
ID [G1]
Authors Vattem KM, Wek RC
Title Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells.
Citation Proc Natl Acad Sci U S A. 2004 Jul 26
Year 2004
Links