| ID |
UX0003 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
08 August 2007 |
|
| Standard Name |
Translation modulators ATF4 uORFs |
| UTRSite Pattern |
1.
ATGGCKYWYTAR
2.
ATGGCGCTTCTCACGGCATTCAGCAGCAGCGTTGCTGTAACCGACAAAGACACCTTCGAATTAAGCACATTCCTCGATTCCAGCAAAGCACCGCAACATGACCGAAATGAGCTTCCTGAGCAGCGAGGTGTTGGTGGGGGACTTGATGTCCCCCTTCGACCAGTCGGGTTTGGGGGCTGA |
|
| UTR Region |
All |
|
| Description |
ATF4 is a basic zipper transcriptional regulatory factor. Levels of ATF4 protein increase in response to eIF2 phosphorylation during amino acid starvation or ER stress. Enhanced levels of ATF4 induce a cascade of transcriptional regulators including CHOP/GADD153 and ATF3, contributing to a program of stress gene expression important for cellular metabolism, the redox status of the cell, and apoptosis. The 5'untranslated region includes two uORFs, the first encodes a polypeptide only three amino acids in length, whereas the second uORF is 59 amino acids in length and overlaps the first 83 nt of coding region. uORF-1 is a positive-acting element that facilitates translation of the ATF4 coding region in response to stress-induced eIF2 phosphorylation. In contrast uORF-2 is inhibitory, blocking ATF4 expression in non-stressed cells. This uORF has been characterized in mouse, and is also conserved in human, chimp, rhesus, cock and dog mRNAs. |
|
|
|
| Feature Key |
uORF |
|
| UTR(s) |
| Description |
Species |
Link |
Ref. |
| Activating transcription factor 4 (ATF4) |
Mus musculus |
UTRef: BR079576 |
[U1] |
|
| Transcript(s) |
| Description |
Species |
Link |
Ref. |
| Activating transcription factor 4 (ATF4) |
Mus musculus |
RefSeq: NM_009716 |
[T1] |
|
| Gene(s) |
| Description |
Species |
Link |
Ref. |
| Activating transcription factor 4 (ATF4) |
Mus musculus |
EntrezGene: 11911 |
[G1] |
|
|
| ID |
[1] |
| Authors |
Vattem KM, Wek RC |
| Title |
Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. |
| Citation |
Proc Natl Acad Sci U S A. 2004 Jul 26 |
| Year |
2004 |
| ID |
[U1] |
| Authors |
Vattem KM, Wek RC |
| Title |
Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. |
| Citation |
Proc Natl Acad Sci U S A. 2004 Jul 26 |
| Year |
2004 |
| ID |
[T1] |
| Authors |
Vattem KM, Wek RC |
| Title |
Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. |
| Citation |
Proc Natl Acad Sci U S A. 2004 Jul 26 |
| Year |
2004 |
| ID |
[G1] |
| Authors |
Vattem KM, Wek RC |
| Title |
Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. |
| Citation |
Proc Natl Acad Sci U S A. 2004 Jul 26 |
| Year |
2004 |
