UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID UX0005
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Glucose-response translation stimulator CD36 uORF
UTRSite Pattern
1.
ATGTTGGAGCATTTGATTGAAAAATCCTTCTTAGCCATTTTAAAGATAGCTTTCCAATGA
 M  L  E  H  L  I  E  K  S  F  L  A  I  L  K  I  A  F  Q  *
2.
ATGATTAGACGAATTGATTCTTTCTGTGACTCATCAGTTCCTTTCCTGTAA
 M  I  R  R  I  D  S  F  C  D  S  S  V  P  F  L  *
3.
ATGTCTTGCTGTTGA
 M  S  C  C  *
::Taxonomy
UTR Region All
::Description
Description CD36 is a "scavenger" receptor responsible for the uptake of oxidized low-density lipoprotein (Ox-LDL) by macrophages. Increased expression of CD36 is correlated with increased Ox-LDL uptake over a range of glucose concentrations. It known that CD36 is a receptor of glycosilated ox-LDL and may be involved in the development of atherosclerosis in diabetics. It has been determined experimentally that the expression of CD36 is regulated at the post-transcriptional level. The 5'UTR region of this gene contains three uORFs. Site-directed mutagenesis of upstream AUG codons, in luciferase reporter constructs bearing the 5'UTR of CD36 indicates that the first uORF stimulates the translation of CD36 in response of increased level of glucose.
::Features
Feature Key uORF
::References
ID [1]
Authors Erik Griffin, Alessandro Re, Nance Hamel, Chenzong Fu, Harry Bush, Timothy McCaffrey & Adam S.Asch
Title A link between diabetes and atherosclerosis: glucose regulates axpression of CD36 at the level of translation
Citation Nat Med. 2001 Jul;7(7):840-6
Year 2001
Links