| ID |
UX0005 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
02 September 2004 |
|
| Standard Name |
Glucose-response translation stimulator CD36 uORF |
| UTRSite Pattern |
1.
ATGTTGGAGCATTTGATTGAAAAATCCTTCTTAGCCATTTTAAAGATAGCTTTCCAATGA
M L E H L I E K S F L A I L K I A F Q *
2.
ATGATTAGACGAATTGATTCTTTCTGTGACTCATCAGTTCCTTTCCTGTAA
M I R R I D S F C D S S V P F L *
3.
ATGTCTTGCTGTTGA
M S C C *
|
|
| UTR Region |
All |
|
| Description |
CD36 is a "scavenger" receptor responsible for the uptake of oxidized low-density lipoprotein (Ox-LDL) by macrophages.
Increased expression of CD36 is correlated with increased Ox-LDL uptake over a range of glucose concentrations.
It known that CD36 is a receptor of glycosilated ox-LDL and may be involved in the development of atherosclerosis in diabetics.
It has been determined experimentally that the expression of CD36 is regulated at the
post-transcriptional level. The 5'UTR region of this gene contains three uORFs.
Site-directed mutagenesis of upstream AUG codons, in luciferase reporter constructs bearing the 5'UTR of CD36 indicates that the first uORF stimulates the translation of CD36 in response of increased level of glucose.
|
|
|
|
| Feature Key |
uORF |
|
| ID |
[1] |
| Authors |
Erik Griffin, Alessandro Re, Nance Hamel, Chenzong Fu, Harry Bush, Timothy McCaffrey & Adam S.Asch |
| Title |
A link between diabetes and atherosclerosis: glucose regulates axpression of CD36 at the level of translation |
| Citation |
Nat Med. 2001 Jul;7(7):840-6 |
| Year |
2001 |
