UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID UX0006
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor DDIT3 uORF
UTRSite Pattern
1.
ATGTTAAAGATGAGCGGGTGGCAGCGACAGAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCAC
 M  L  K  M  S  G  W  Q  R  Q  S  Q  N  Q  S  W  N  L  R  R  E  C  S  R  R  K  C  I  F  I  H  H  H
ACCTGA
 T  *
2.
ATGAGCGGGTGGCAGCGACAGAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGA
 M  S  G  W  Q  R  Q  S  Q  N  Q  S  W  N  L  R  R  E  C  S  R  R  K  C  I  F  I  H  H  H  T  * 
::Taxonomy
UTR Region All
::Description
Description Chop (DDIT3) is a ubiquitously expressed mammalian gene encoding a small nuclear protein related to the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. This gene is induced, in a wide variety of cells, by stresses such as genotoxic agents, oxidative or reductive stress and glucose deprivation which cause DNA damage or decreased function of the endoplasmic reticulum. The 5'UTR contain three uAUG, both uAUG-1 and uAUG-2 are in-frame with the same stop codon (UGA), the thi......
::Features
Feature Key uORF
::References
ID [1]
Authors Jousse C, Bruhat A, Carraro V, Urano F, Ferrara M, Ron D, Fafournoux P
Title Inhibition of CHOP translation by a peptide encoded by an open reading frame localized in the chop 5'UTR.
Citation Nucleic Acids Res. 2001 Nov 1;29(21):4341-51
Year 2001
Links