UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID UX0006
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor DDIT3 uORF
UTRSite Pattern
1.
ATGTTAAAGATGAGCGGGTGGCAGCGACAGAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCAC
 M  L  K  M  S  G  W  Q  R  Q  S  Q  N  Q  S  W  N  L  R  R  E  C  S  R  R  K  C  I  F  I  H  H  H
ACCTGA
 T  *
2.
ATGAGCGGGTGGCAGCGACAGAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGA
 M  S  G  W  Q  R  Q  S  Q  N  Q  S  W  N  L  R  R  E  C  S  R  R  K  C  I  F  I  H  H  H  T  * 
::Taxonomy
UTR Region All
::Description
Description Chop (DDIT3) is a ubiquitously expressed mammalian gene encoding a small nuclear protein related to the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. This gene is induced, in a wide variety of cells, by stresses such as genotoxic agents, oxidative or reductive stress and glucose deprivation which cause DNA damage or decreased function of the endoplasmic reticulum. The 5'UTR contain three uAUG, both uAUG-1 and uAUG-2 are in-frame with the same stop codon (UGA), the thi......
::Features
Feature Key uORF
::References
ID [1]
Authors Jousse C, Bruhat A, Carraro V, Urano F, Ferrara M, Ron D, Fafournoux P
Title Inhibition of CHOP translation by a peptide encoded by an open reading frame localized in the chop 5'UTR.
Citation Nucleic Acids Res. 2001 Nov 1;29(21):4341-51
Year 2001