| ID |
UX0007 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
02 September 2004 |
|
| Standard Name |
Translation inhibitor HD uORF. |
| UTRSite Pattern |
ATGGACGGCCGCTCAGGTTCTGCTTTTACCTGCGGCCCAGAGCCCCATTCATTGCCCCGGTGCTGA
M D G R S G S A F T C G P E P H S L P R C *
|
|
| UTR Region |
All |
|
| Description |
HD (the gene encoding the huntingtin protein) is a gene in which a expansion of a (CAG)n repeat within the coding region cause Huntington's disease.
Variable expression of the could be responsible for the variable penetrance of Huntington's disease, given that variation in HD protein levels occurs within the human striatum and cell types where increased expression corresponds to affected sites.
An uORF is present within the 5'untraslated region of the HD mRNA. This uORF encode a polypeptide of 21 amino acids. The initiator codon of the uORF is in a favourable context.
The uORF within the HD inhibits expression of the huntingtin gene product. Mutation analysis indicates that the majority of ribosomes initiate translation at the uORF, with only a small fraction initiating at the downstream start site. The uORF is present in the HD genes from human, gorilla, chimpanzee, pig, rat and mouse and there is a conserved motif at the C-terminus of the encoded polypeptide of the uORF.
|
|
|
|
|
| ID |
[1] |
| Authors |
Lee J, Park EH, Couture G, Harvey I, Garneau P, Pelletier J |
| Title |
An upstream open reading frame impedes translation of the huntingtin gene |
| Citation |
Nucleic Acids Res. 2002 Dec 1;30(23):5110-9 |
| Year |
2002 |
