UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID UX0007
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor HD uORF.
UTRSite Pattern 
ATGGACGGCCGCTCAGGTTCTGCTTTTACCTGCGGCCCAGAGCCCCATTCATTGCCCCGGTGCTGA
 M  D  G  R  S  G  S  A  F  T  C  G  P  E  P  H  S  L  P  R  C  *
::Taxonomy
UTR Region All
::Description
Description HD (the gene encoding the huntingtin protein) is a gene in which a expansion of a (CAG)n repeat within the coding region cause Huntington's disease. Variable expression of the could be responsible for the variable penetrance of Huntington's disease, given that variation in HD protein levels occurs within the human striatum and cell types where increased expression corresponds to affected sites. An uORF is present within the 5'untraslated region of the HD mRNA. This uORF encode a polypeptide of......
::Features
::References
ID [1]
Authors Lee J, Park EH, Couture G, Harvey I, Garneau P, Pelletier J
Title An upstream open reading frame impedes translation of the huntingtin gene
Citation Nucleic Acids Res. 2002 Dec 1;30(23):5110-9
Year 2002