| ID |
UX0008 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
02 September 2004 |
|
| Standard Name |
Translation inhibitor HERBB2 uORF |
| UTRSite Pattern |
ATGGGGCCGGAGCCGCAGTGA
M G P E P Q *
|
|
| UTR Region |
All |
|
| Description |
Overexpression of HER-2 (neu, erbB-2) results in cellular transformation and is associated with a variety of human cancers.
The HER-2 oncogene encodes a 185-kDa transmembrane receptor tyrosine kinase. Its expression is regulated at the translational level.
There are two distinct translational mechanisms controling erbB-2 protein expression: the first is a cell type-dependent mechanism that causes increased erbB-2 translation while the second is a cell type-independent repression of downstream translation, mediated by an uORF.
Mutation of the upstream AUG codon eliminates the uORF and results in an approximately 5-fold increase in downstream translation.
This inhibitory regulation may be mediated by the very short intercistronic spacing between the uORF and the downstream cistron.
|
|
|
|
| Feature Key |
uORF |
|
| ID |
[1] |
| Authors |
Stephanie J. Child, Melanie K. Miller, and Adam P. Geballe |
| Title |
Translational control by an upstream open reading frame in the HER-2/neu transcript |
| Citation |
J Biol Chem. 1999 Aug 20;274(34):24335-41. |
| Year |
1999 |
