UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID UX0008
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor HERBB2 uORF
UTRSite Pattern
ATGGGGCCGGAGCCGCAGTGA 
 M  G  P  E  P  Q  *
::Taxonomy
UTR Region All
::Description
Description Overexpression of HER-2 (neu, erbB-2) results in cellular transformation and is associated with a variety of human cancers. The HER-2 oncogene encodes a 185-kDa transmembrane receptor tyrosine kinase. Its expression is regulated at the translational level. There are two distinct translational mechanisms controling erbB-2 protein expression: the first is a cell type-dependent mechanism that causes increased erbB-2 translation while the second is a cell type-independent repression of downstream ......
::Features
Feature Key uORF
::References
ID [1]
Authors Stephanie J. Child, Melanie K. Miller, and Adam P. Geballe
Title Translational control by an upstream open reading frame in the HER-2/neu transcript
Citation J Biol Chem. 1999 Aug 20;274(34):24335-41.
Year 1999