UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID UX0009
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor MDM2 uORFs
UTRSite Pattern
1.      
ATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGA
 M  E  Q  E  A  E  P  E  G  R  P  R  P  L  *
2.
ATGATCCCCGAGGCCCAGGGCGTCGTGCTTCCGCGCGCCCCGTGA
 M  I  P  E  A  Q  G  V  V  L  P  R  A  P  *
::Taxonomy
UTR Region All
::Description
Description MDM2 is a nuclear phosphoprotein that binds and inhibits transactivation by protein p53, as part of an autoregulatory negative feedback loop. Two transcript variants, L-mdm2 and S-mdm2, differing in the length of the 5'UTR, may be expressed. L-mdm2 results in low constitutive level of protein, while the transcript S-mdm2 seems be actively translated. L-mdm2 contains a 5' leader derived from exon 1 and contains two upstream ORFs absent from S-mdm2. In chimeric constructs containing both the 5' leader of L-mdm2 and the human growth hormone (hGH) coding region, the presence of both uORFs suppressed translation of the downstream gene (hGH). In contrast, disruption the start codons of either the first or the second uORF stimulated ribosome loading resulting in elevated translation.
::Features
Feature Key uORF
::References
ID [1]
Authors Jin X, Turcott E, Englehardt S, Mize GJ, Morris DR
Title The two upstream open reading frames of oncogene mdm2 have different translational regulatory properties.
Citation J Biol Chem. 2003 Jul 11;278(28):25716-21. Epub 2003 May 02
Year 2003
ID [2]
Authors Brown CY, Mize GJ, Pineda M, George DL, Morris DR
Title Role of two upstream open reading frames in the translational control of oncogene mdm2
Citation Oncogene. 1999 Oct 7;18(41):5631-7
Year 1999
Links