| ID |
UX0009 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
02 September 2004 |
|
| Standard Name |
Translation inhibitor MDM2 uORFs |
| UTRSite Pattern |
1.
ATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGA
M E Q E A E P E G R P R P L *
2.
ATGATCCCCGAGGCCCAGGGCGTCGTGCTTCCGCGCGCCCCGTGA
M I P E A Q G V V L P R A P *
|
|
| UTR Region |
All |
|
| Description |
MDM2 is a nuclear phosphoprotein that binds and inhibits transactivation by protein p53, as part of an autoregulatory negative feedback loop.
Two transcript variants, L-mdm2 and S-mdm2, differing in the length of the 5'UTR, may be expressed.
L-mdm2 results in low constitutive level of protein, while the transcript S-mdm2 seems be actively translated.
L-mdm2 contains a 5' leader derived from exon 1 and contains two upstream ORFs absent from S-mdm2.
In chimeric constructs containing both the 5' leader of L-mdm2 and the human growth hormone (hGH) coding region, the presence of both uORFs suppressed translation of the downstream gene (hGH).
In contrast, disruption the start codons of either the first or the second uORF stimulated ribosome loading resulting in elevated translation.
|
|
|
|
| Feature Key |
uORF |
|
| ID |
[1] |
| Authors |
Jin X, Turcott E, Englehardt S, Mize GJ, Morris DR |
| Title |
The two upstream open reading frames of oncogene mdm2 have different translational regulatory properties. |
| Citation |
J Biol Chem. 2003 Jul 11;278(28):25716-21. Epub 2003 May 02 |
| Year |
2003 |
| ID |
[2] |
| Authors |
Brown CY, Mize GJ, Pineda M, George DL, Morris DR |
| Title |
Role of two upstream open reading frames in the translational control of oncogene mdm2 |
| Citation |
Oncogene. 1999 Oct 7;18(41):5631-7 |
| Year |
1999 |
