| ID |
UX0009 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
02 September 2004 |
|
| Standard Name |
Translation inhibitor MDM2 uORFs |
| UTRSite Pattern |
1.
ATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGA
M E Q E A E P E G R P R P L *
2.
ATGATCCCCGAGGCCCAGGGCGTCGTGCTTCCGCGCGCCCCGTGA
M I P E A Q G V V L P R A P *
|
|
| UTR Region |
All |
|
| Description |
MDM2 is a nuclear phosphoprotein that binds and inhibits transactivation by protein p53, as part of an autoregulatory negative feedback loop.
Two transcript variants, L-mdm2 and S-mdm2, differing in the length of the 5'UTR, may be expressed.
L-mdm2 results in low constitutive level of protein, while the transcript S-mdm2 seems be actively translated.
L-mdm2 contains a 5' leader derived from exon 1 and contains two upstream ORFs absent from S-mdm2.
In chimeric constructs containing both the 5...... |
|
|
|
| Feature Key |
uORF |
|
| ID |
[1] |
| Authors |
Jin X, Turcott E, Englehardt S, Mize GJ, Morris DR |
| Title |
The two upstream open reading frames of oncogene mdm2 have different translational regulatory properties. |
| Citation |
J Biol Chem. 2003 Jul 11;278(28):25716-21. Epub 2003 May 02 |
| Year |
2003 |
| ID |
[2] |
| Authors |
Brown CY, Mize GJ, Pineda M, George DL, Morris DR |
| Title |
Role of two upstream open reading frames in the translational control of oncogene mdm2 |
| Citation |
Oncogene. 1999 Oct 7;18(41):5631-7 |
| Year |
1999 |
