UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID UX0009
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor MDM2 uORFs
UTRSite Pattern
1.      
ATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGA
 M  E  Q  E  A  E  P  E  G  R  P  R  P  L  *
2.
ATGATCCCCGAGGCCCAGGGCGTCGTGCTTCCGCGCGCCCCGTGA
 M  I  P  E  A  Q  G  V  V  L  P  R  A  P  *
::Taxonomy
UTR Region All
::Description
Description MDM2 is a nuclear phosphoprotein that binds and inhibits transactivation by protein p53, as part of an autoregulatory negative feedback loop. Two transcript variants, L-mdm2 and S-mdm2, differing in the length of the 5'UTR, may be expressed. L-mdm2 results in low constitutive level of protein, while the transcript S-mdm2 seems be actively translated. L-mdm2 contains a 5' leader derived from exon 1 and contains two upstream ORFs absent from S-mdm2. In chimeric constructs containing both the 5......
::Features
Feature Key uORF
::References
ID [1]
Authors Jin X, Turcott E, Englehardt S, Mize GJ, Morris DR
Title The two upstream open reading frames of oncogene mdm2 have different translational regulatory properties.
Citation J Biol Chem. 2003 Jul 11;278(28):25716-21. Epub 2003 May 02
Year 2003
ID [2]
Authors Brown CY, Mize GJ, Pineda M, George DL, Morris DR
Title Role of two upstream open reading frames in the translational control of oncogene mdm2
Citation Oncogene. 1999 Oct 7;18(41):5631-7
Year 1999