UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID UX0010
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor CDKN1B uORF
UTRSite Pattern
ATGGATCTCCTCCTCTGTTTAAATAGACTCGCCGTGTCAATCATTTTCTTCTTCGTCAGCCTCCCTTCCACCGCCATATTGGGCCACTAA
 M  D  L  L  L  C  L  N  R  L  A  V  S  I  I  F  F  F  V  S  L  P  S  T  A  I  L  G  H  *
::Taxonomy
UTR Region All
::Description
Description The Cdk inhibitory protein p27 play a key role in regulating Cdk activity during G1 progression and in growth arrest. Level of the inhibitory protein oscillate during the cell cycle and peak in G1 phase. Under most conditions investigated, p27 oscillations are the result of post-trascriptional mechanisms that include translational control and regulated protein stability. Since p27 transcripts of various length have been described that differ in length of their 5'UTR between 152 and 575 nucleotides wished, so alternative transcription start sites might contribute to the regulated translation of p27. The short open reading frame codes for a peptide of 29 amino acids, a significant increase in p27 synthesis was observed after elimination or mutation of the initiation codon. The mutation of start codon reduced cell cycle regulation of reporter translation to about 50%.
::Features
Feature Key uORF
::References
ID [1]
Authors Kullmann M, Gopfert U, Siewe B, Hengst L.
Title ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR.
Citation Genes Dev. 2002 Dec 1;16(23):3087-99.
Year 2002
ID [2]
Authors Gopfert U, Kullmann M, Hengst L.
Title Cell cycle-dependent translation of p27 involves a responsive element in its 5'-UTR that overlaps with a uORF.
Citation Hum Mol Genet. 2003 Jul 15;12(14):1767-79
Year 2003
Links