| ID |
UX0010 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
02 September 2004 |
|
| Standard Name |
Translation inhibitor CDKN1B uORF |
| UTRSite Pattern |
ATGGATCTCCTCCTCTGTTTAAATAGACTCGCCGTGTCAATCATTTTCTTCTTCGTCAGCCTCCCTTCCACCGCCATATTGGGCCACTAA
M D L L L C L N R L A V S I I F F F V S L P S T A I L G H *
|
|
| UTR Region |
All |
|
| Description |
The Cdk inhibitory protein p27 play a key role in regulating Cdk activity during G1 progression and in growth arrest.
Level of the inhibitory protein oscillate during the cell cycle and peak in G1 phase. Under most conditions investigated, p27 oscillations are the result of post-trascriptional mechanisms that include translational control and regulated protein stability.
Since p27 transcripts of various length have been described that differ in length of their 5'UTR between 152 and 575 nucleotides wished, so alternative transcription start sites might contribute to the regulated translation of p27.
The short open reading frame codes for a peptide of 29 amino acids, a significant increase in p27 synthesis was observed after elimination or mutation of the initiation codon. The mutation of start codon reduced cell cycle regulation of reporter translation to about 50%.
|
|
|
|
| Feature Key |
uORF |
|
| ID |
[1] |
| Authors |
Kullmann M, Gopfert U, Siewe B, Hengst L. |
| Title |
ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR. |
| Citation |
Genes Dev. 2002 Dec 1;16(23):3087-99. |
| Year |
2002 |
| ID |
[2] |
| Authors |
Gopfert U, Kullmann M, Hengst L. |
| Title |
Cell cycle-dependent translation of p27 involves a responsive element in its 5'-UTR that overlaps with a uORF. |
| Citation |
Hum Mol Genet. 2003 Jul 15;12(14):1767-79 |
| Year |
2003 |
