UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID UX0011
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation modulator RARB2 uORFs.
UTRSite Pattern 
1.
ATGCAGAGGACGCGAGCCACCCGGGCAGGGAGCGTCTGGGCACCGGCGGGGTAG
 M  Q  R  T  R  A  T  R  A  G  S  V  W  A  P  A  G  *
2.
ATGGTAAATGATCATTTGGATCAATTACAGGCTTTTAGCTGGCTTGTCTGTCATAATTCATGA
 M  V  N  D  H  L  D  Q  L  Q  A  F  S  W  L  V  C  H  N  S  *
3.
ATGATCATTTGGATCAATTACAGGCTTTTAGCTGGCTTGTCTGTCATAATTCATGATTCGGGGCTGGGAAAAAGACCAACAGCCTACGTGCCAAAAAAGGGGCAGAGTTTGATGGAGTTCGTGGACTTTTCTGTGCGGCTCGCCTCCACACCTAGAGGATAA
 M  I  I  W  I  N  Y  R  L  L  A  G  L  S  V  I  I  H  D  S  G  L  G  K  R  P  T  A  Y  V  P  K  K  G  Q  S  L  M  E  F  V  D  F  S  V  R  L  A  S  T  P  R  G  *
4.
ATGATTCGGGGCTGGGAAAAAGACCAACAGCCTACGTGCCAAAAAAGGGGCAGAGTTTGA
 M  I  R  G  W  E  K  D  Q  Q  P  T  C  Q  K  R  G  R  V  *
5.
ATGGAGTTCGTGGACTTTTCTGTGCGGCTCGCCTCCACACCTAGAGGATAA
 M  E  F  V  D  F  S  V  R  L  A  S  T  P  R  G  *
::Taxonomy
UTR Region All
::Description
Description The retinoic acid receptor-b (RARb) is a retinoic acid-dependent transcription factor that belongs to the steroid/thyroid hormone receptor superfamily. Retinoic acid plays a fundamental role in embrional development, homeostasis and cellular differentiation. The RARb gene encodes at least four different transcripts which derive from differential splicing. The four alternative transcripts encode identical DNA and hormone binding domains but their 5'UTR and NH2-terminal domains differ. RARb2 isoform has an unusually long 5'UTR which forms a stable secondary structure containing five uORFs. It has been experimentally demonstrated that these uORFs function as tissue specific regulatory elements (the first stimulates expression in the heart while the others inhibit translation).
::Features
Feature Key uORF
::References
ID [1]
Authors Andreas Zimmer, Anne M. Zimmer, Key Reynolds
Title Tissue specific expression of the retinoic acid receptor-beta 2: regulation by short open reading frames in the 5'-noncoding region
Citation J Cell Biol. 1994 Nov;127(4):1111-9.
Year 1994
ID [2]
Authors Key Reynolds, Anne M. Zimmer, Andreas Zimmer
Title Regulation of RARb2 mRNA expression: evidence for an ihibitory peptide encoded in the 5'-untraslated region
Citation J Cell Biol. 1996 Aug;134(4):827-35
Year 1996