| ID |
UX0012 |
|
| Creation Date |
02 September 2004 |
| Updating Date |
02 September 2004 |
|
| Standard Name |
Translation inhibitor AVPR1B uORFs |
| UTRSite Pattern |
1.
ATGGCAGCATAG
M A A *
2.
ATGGTCCTGGATGGCACCTTCAAGACAACTTAG
M V L D G T F K T T *
3.
ATGGCACCTTCAAGACAACTTAGGGAGGTCTACTCTCTCCAGTTCCAAAAGAAAGTTTGGACAAAGTGA
M A P S R Q L R E V Y S L Q F Q K K V W T K *
4.
ATGGCAGCTGCTTCCTCTGTGTCACCTCTCAGAAGCCCCTGCCTCCAACCCACTCCAACCTTCCCACACTGA
M A A A S S V S P L R S P C L Q P T P T F P H *
5.
ATGTTGGTCCTGTTCCCTTCTCCTTTCATTGTCCTTTCCATCTGTCTGCTGAGCTGTCTCACCTGTTTCTACTTTCACCCCATCGTCACCCCTCACCTCCCTTCTCTCCACCTCTAA
M L V L F P S P F I V L S I C L L S C L T C F Y F H P I V T P H L P S L H L *
|
|
| UTR Region |
All |
|
| Description |
V1b vasopressin receptor are known to be expressed in the corticotroph cells of the pituitary.
The protein encoded by this gene acts as receptor for arginine vasopressin and its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system.
Multiple upstream open reading frames (uORF) were found to be located in the 5'-untraslated region of the gene. The first uORF was experimentally analised because it is very close to the transcription start site. Each uORF was individually inactivated by introduction a point mutation within ATG, the results suggested that all uORFs are responsible for the inhibitory effect, but uORF4-5 inhibit more than uORF2-3. It was determined that the amino acid peptide encoded by uORF-3 is important for the translation inhibition and likely an intracellar calcium-mediated signalling pathway might regulate the expression of the V1b receptor post-trascriptionally through the uORFs. |
|
|
|
| Feature Key |
uORF |
|
| ID |
[1] |
| Authors |
Nomura A, Iwasaki Y, Saito M, Aoki Y, Yamamori E, Ozaki N, Tachikawa K, Mutsuga N, Morishita M, Yoshida M, Asai M, Oiso Y, Saito H. |
| Title |
Involvement of upstream open reading frames in regulation of rat V(1b) vasopressin receptor expression. |
| Citation |
Am J Physiol Endocrinol Metab. 2001 May;280(5) |
| Year |
2001 |
