UTRSite Logo
user: guest
References
UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2010; 38 (Database issue): D75-D80.

UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2005 Jan 1; 33 (Database issue): D141-6.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002.
Nucleic Acids Res. 2002 Jan 1; 30 (1): 335-40.

UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs.
Nucleic Acids Res. 2000 Jan 1; 28 (1): 193-6

Signal Manager :: View

::General Information
ID UX0012
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor AVPR1B uORFs
UTRSite Pattern
1.
ATGGCAGCATAG
 M  A  A  *
2.
ATGGTCCTGGATGGCACCTTCAAGACAACTTAG
 M  V  L  D  G  T  F  K  T  T  *
3.
ATGGCACCTTCAAGACAACTTAGGGAGGTCTACTCTCTCCAGTTCCAAAAGAAAGTTTGGACAAAGTGA
 M  A  P  S  R  Q  L  R  E  V  Y  S  L  Q  F  Q  K  K  V  W  T  K  *
4.
ATGGCAGCTGCTTCCTCTGTGTCACCTCTCAGAAGCCCCTGCCTCCAACCCACTCCAACCTTCCCACACTGA
 M  A  A  A  S  S  V  S  P  L  R  S  P  C  L  Q  P  T  P  T  F  P  H  *
5.
ATGTTGGTCCTGTTCCCTTCTCCTTTCATTGTCCTTTCCATCTGTCTGCTGAGCTGTCTCACCTGTTTCTACTTTCACCCCATCGTCACCCCTCACCTCCCTTCTCTCCACCTCTAA
 M  L  V  L  F  P  S  P  F  I  V  L  S  I  C  L  L  S  C  L  T  C  F  Y  F  H  P  I  V  T  P  H  L  P  S  L  H  L  *
::Taxonomy
UTR Region All
::Description
Description V1b vasopressin receptor are known to be expressed in the corticotroph cells of the pituitary. The protein encoded by this gene acts as receptor for arginine vasopressin and its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. Multiple upstream open reading frames (uORF) were found to be located in the 5'-untraslated region of the gene. The first uORF was experimentally analised because it is very close to the transcription start site. ......
::Features
Feature Key uORF
::References
ID [1]
Authors Nomura A, Iwasaki Y, Saito M, Aoki Y, Yamamori E, Ozaki N, Tachikawa K, Mutsuga N, Morishita M, Yoshida M, Asai M, Oiso Y, Saito H.
Title Involvement of upstream open reading frames in regulation of rat V(1b) vasopressin receptor expression.
Citation Am J Physiol Endocrinol Metab. 2001 May;280(5)
Year 2001
Links