UTRSite Logo
user: guest

Signal Manager :: View

::General Information
ID UX0012
Creation Date 02 September 2004
Updating Date 02 September 2004
Standard Name Translation inhibitor AVPR1B uORFs
UTRSite Pattern
1.
ATGGCAGCATAG
 M  A  A  *
2.
ATGGTCCTGGATGGCACCTTCAAGACAACTTAG
 M  V  L  D  G  T  F  K  T  T  *
3.
ATGGCACCTTCAAGACAACTTAGGGAGGTCTACTCTCTCCAGTTCCAAAAGAAAGTTTGGACAAAGTGA
 M  A  P  S  R  Q  L  R  E  V  Y  S  L  Q  F  Q  K  K  V  W  T  K  *
4.
ATGGCAGCTGCTTCCTCTGTGTCACCTCTCAGAAGCCCCTGCCTCCAACCCACTCCAACCTTCCCACACTGA
 M  A  A  A  S  S  V  S  P  L  R  S  P  C  L  Q  P  T  P  T  F  P  H  *
5.
ATGTTGGTCCTGTTCCCTTCTCCTTTCATTGTCCTTTCCATCTGTCTGCTGAGCTGTCTCACCTGTTTCTACTTTCACCCCATCGTCACCCCTCACCTCCCTTCTCTCCACCTCTAA
 M  L  V  L  F  P  S  P  F  I  V  L  S  I  C  L  L  S  C  L  T  C  F  Y  F  H  P  I  V  T  P  H  L  P  S  L  H  L  *
::Taxonomy
UTR Region All
::Description
Description V1b vasopressin receptor are known to be expressed in the corticotroph cells of the pituitary. The protein encoded by this gene acts as receptor for arginine vasopressin and its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. Multiple upstream open reading frames (uORF) were found to be located in the 5'-untraslated region of the gene. The first uORF was experimentally analised because it is very close to the transcription start site. ......
::Features
Feature Key uORF
::References
ID [1]
Authors Nomura A, Iwasaki Y, Saito M, Aoki Y, Yamamori E, Ozaki N, Tachikawa K, Mutsuga N, Morishita M, Yoshida M, Asai M, Oiso Y, Saito H.
Title Involvement of upstream open reading frames in regulation of rat V(1b) vasopressin receptor expression.
Citation Am J Physiol Endocrinol Metab. 2001 May;280(5)
Year 2001